Review



foxp3 transcription factor staining buffer  (Miltenyi Biotec)


Bioz Verified Symbol Miltenyi Biotec is a verified supplier
Bioz Manufacturer Symbol Miltenyi Biotec manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    Miltenyi Biotec foxp3 transcription factor staining buffer
    Foxp3 Transcription Factor Staining Buffer, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 230 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer/FoxP3+Staining+Buffer+Set/10__1016_slash_j__celrep__2026__117140-315-98-96
    Average 97 stars, based on 230 article reviews
    foxp3 transcription factor staining buffer - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Staining:

    Article Title: A beneficial environment promotes immune resilience through epigenetic regulation
    Article Snippet: The cells were first incubated with anti-CD16/32 blocking antibody (Invitrogen, no. 23348094) and then stained with Live/Dead cell viability dye (Zombie Aqua or Fixable Viability Stain 620) and antibodies for surface markers (table S1). .. The cells were fixed and permeabilized using the Foxp3/Transcription Factor Staining Buffer Set (Miltenyi Biotec, 130-093-142) and subsequently stained with intracellular markers (table S1). .. The samples were analyzed using the BD FACSymphony A1 Cell Analyzer running BD FACSDiva v8.

    Article Title: In adult X-CGD patients, regulatory T cells are expanded while activated T cells display a NOX2-independent ROS increase.
    Article Snippet: .. Then, cells were fixed and permeabilized with the FOXP3/Transcription Factor Staining Buffer Set for 30 min at 4 ◦C and were intracellularly stained in permeabilization buffer for 30 min at room temperature with the following mAbs: FITC TNFα (Miltenyi), PerCP IL-2 (Biolegend) and APC FOXP3 (eBioscience). .. Statistical analysis was performed using Prism software (version 6.0; GraphPad, San Diego, CA, USA).

    Article Title: DNA architectural protein CTCF facilitates subset-specific chromatin interactions to limit the formation of memory CD8 + T cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER AMPure XP beads Beckman Coulter Cat#A63880 Brilliant II Sybr Green Agilent Technologies Cat#600828 Phenol-Chloroform Invitrogen Cat#15593049 DPBS Gibco Cat#14190250 Concanavalin A beads Bangs Laboratories Cat#BP531 CaCl2 Fisher Scientific Cat# BP510-500 RNase A Qiagen Cat#19101 Glycogen Millipore Sigma Cat#10901393001 SDS Fisher Scientific Cat#BP166-100 Proteinase K Fisher Scientific Cat#BP1700-50 Ethanol Sigma-Aldrich Cat#E7023-500ML Maxtract High-density tubes Qiagen Cat#129046 KCl Sigma-Aldrich Cat#P3911-25G Spermidine Sigma-Aldrich Cat#S2501-5G PEG 8000 Sigma-Aldrich Cat#202452-500G NaCl Thermo Fisher Scientific Cat# S271-500 EDTA Thermo Fisher Scientific Cat#17892 EGTA Sigma Aldrich Cat#E3889 Triton X-100 Sigma Aldrich Cat#X100-5ML cOmplete , EDTA-free Protease Inhibitor Cocktail Millipore Sigma Cat#5056489001 Formaldehyde Sigma-Aldrich Cat# FP8775 Glycine Thermo Fisher Scientific Cat# BP381-5 Agarose Thermo Fisher Scientific Cat# BP1356-500 Benzamidine Sigma-Aldrich Cat#B6506-5G Proteinase Inhibitor Cocktail Calbiochem Cat#539137-10VL Dynabeads Protein G Invitrogen Cat#10003D Tris base Thermo Fisher Scientific Cat# BP152-5 NP-40 Sigma-Aldrich Cat# 11332473001 NaDOC Sigma-Aldrich Cat# D6750-25G Ultrapure Water Fisher Scientific Cat# 10-977-015 Quick Ligation Kit New England Bioscience Cat# M2200S Quick Ligase New England Bioscience Cat#E7337A Nanosep MF Filter Tube VWR Cat#29300-642 Sybr Gold Invitrogen Cat#S11494 40% Polyacrylamide Biorad Cat# 161-0146 Ammonium Persulfate VWR Cat# EM-2300 TEMED VWR Cat# PAV3161 6x loading dye Thermo Fisher Scientific Cat# R0631 NaOAC Thermo Fisher Scientific Cat# S25531 Glycoblue Invitrogen Cat# AM9515 NEBNext High Fidelity 2X PCR Master Mix New England Bioscience Cat# M0541L MboI-HF enzyme New England Bioscience Cat#R0147 Biotin-14-dATP Life Technologies Cat#19523-016 DNA Polymerase (Klenow) New England Bioscience Cat#M0210 10x NEB buffer New England Bioscience Cat#B0202 T4 DNA Ligase New England Bioscience Cat#M0202 Dynabeads Streptavidin Life Technologies Cat#65602 (Continued on next page) Immunity 56, 959–978.e1–e10, May 9, 2023 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Klenow exo minus New England Bioscience Cat#M0212 NEBNext Ultra II Q5 Master Mix New England Bioscience Cat#M0544S Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#554714 Foxp3/Transcription Factor Staining Buffer Set eBiosciences Cat#00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#MIR 2300 LS Columns Miltenyi Biotec Cat#130-042 APC BrdU Kit BD Biosciences Cat#557892; RRID:AB_2861367 FlexiGene Kit Qiagen Cat#51206 Superscript II Thermo Fisher Scientific Cat#18-064-014 Zymo DNA Clean&Concentrator Zymo Research Cat#D4030 End-it DNA End-repair Kit Lucigen Cat#ER81050 NEB Library Index New England Biosciences Cat#E7600S Qubit dsDNA HS Assay Thermo Fisher Scientific Cat#Q32851 Deposited data CD8+ T cell histone modifications ChIP Yu et al.14 GSE89036 Patient RNA Seq Gregor et al.47; Konrad et al.48 GSE46833 Tbet ChIP-Seq Dominguez et al.41 PRJNA287664 Hi-C Sequencing This paper GSE205081 Naive and Memory Hi-C Sequencing Russ et al.32 GSE225885 CTCF knockdown RNA Sequencing This paper GSE205079 CTCF ChIP-Seq This paper GSE205077 Input ChIP-Seq Yu et al.14 GSE89036 CTCF Cut&Run This paper GSE205077 CTCF knockdown Cut&Run This paper GSE205077 CTCF knockdown ATAC This paper GSE205076 Experimental models: Cell lines B16-GP33-41 Dr. A. Lamarre, INRS-institut Armand-Frappier N/A PLAT-E Cell Biolabs Cat#RV-101; RRID: CCL_B488 Experimental models: Organisms/strains P14 (B6.Cg-Tcratm1Mom Tg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Cat#037394-JAX; RRID: MMRRC_037394-JAX OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID: IMRS_JAX:003831 CD45.2 (C57BL/6J) The Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Cat#002014; RRID: IMSR_JAX:002014 CD45.1.2 Bred in-house N/A Oligonucleotides CTCF- forward for qPCR: 5’- AGTGAAAATGCTGAGCCGGA-3’ IDT N/A CTCF-reverse for qPCR: 5’- ATGATGGCTGTTGGCTGGTT-3’ IDT N/A Hprt-forward for qPCR: 5’- GGCCAGACTTTGTTGGATTT-3’ IDT N/A Hprt-reverse for qPCR: 5’- CAACTTGCGCTCATCT-3’. .. IDT N/A Gapdh-forward for qPCR:5’AGGTCGGTGTGAACGGATTTG-3’ IDT N/A (Continued on next page) e4 Immunity 56, 959–978.e1–e10, May 9, 2023

    Article Title: Glutathione de novo synthesis but not recycling process coordinates with glutamine catabolism to control redox homeostasis and directs murine T cell differentiation
    Article Snippet: DOI: https://doi.org/10.7554/eLife.36158 16 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Genetic reagent (Mus musculus) CD4-Cre Gclcflox/flox PMID:23226398 Genetic reagent (Mus musculus) Gclm-KO PMID:12384496 Genetic reagent (Mus musculus) ROSA26CreERT2 RRID: IMSR_JAX:008463 The Jackson Laboratory Genetic reagent (Mus musculus) GSR-KO PMID: 10218442 Antibody Mouse antiCD3 mAb Cat. #:BE0001-1, RRID:AB_1107634 BioXcell Antibody Mouse antiCD28 mAb Cat. #BE0015-1 RRID:AB_1107624 BioXcell Antibody Mouse anti -IL2 mAb Cat.#BE0043 RRID::AB_1107702 BioXcell Antibody Mouse antiIL4 mAb Cat. #BE0045 RRID:AB_1107707 BioXcell Antibody Mouse antiIFNg mAb Cat. #BE0055 RRID:AB_1107694 BioXcell Antibody Anti mouse CD4-FITC Cat. #11–0042 RRID:AB_464897 eBioscience (1:200) Antibody Anti mouse CD4-APC Cat. #17-0041-81 RRID:AB_469319 eBioscience (1:200) Antibody Anti mouse CD8-APC-Cy7 Cat. #100714 RRID:AB_312753 Biolegend (1:200) Antibody Anti mouse Foxp3-APC Cat. # RRID:AB_469456 eBioscience (1:200) Antibody Anti mouse IL-17A-PECy7 Cat. #25-7177-82 RRID:AB_10732356 eBioscience (1:200) Antibody Anti GCLC antibody (rabbit monoclonal) Cat. #ab190685 RRID:AB_10975474 Abcam WB (1:1000) Antibody Anti GCLM antibody (rabbit monoclonal) Cat. #ab124827 RRID:AB_10975474 Abcam WB (1:1000) Antibody anti-mouse CD25 -PE Cat. #101904 RRID:AB_312847 Biolegend (1:200) Antibody anti-mouse CD69-PECy7 Cat. #552879 RRID:AB_394508 BD Bioscience (1:200) Antibody Anti mouse monoclonal CD3 Cat. #sc-101442 RRID:AB_1120355 Santa Cruz IHC (1:50) Antibody Anti mouse monoclonal galectin-3 Cat. #sc-32790, RRID:AB_627657 Santa Cruz IHC (1:50) Peptide, recombinant protein MOG35-55 peptide synthesized and HPLC-purified St. Jude Hartwell Center for Biotechnology Peptide, recombinant protein Recombinant mouse IL-6 216–16 Peprotech Peptide, recombinant protein Recombinant human TGFb 100–21 c Peprotech Continued on next page Lian et al. eLife 2018;7:e36158. .. DOI: https://doi.org/10.7554/eLife.36158 17 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Peptide, recombinant protein Recombinant human or mouse IL-2 200–02 Peprotech Commercial assay or kit Foxp3/Transcription Factor Staining Buffer Set 00-5523-00 e-Bioscience Commercial assay or kit Naive CD4 + T cell isolation kit,mouse 5160725186 Miltenyi Biotec Commercial assay or kit CD45R(B220) microbeads, mouse 5150309030 Miltenyi Biotec Commercial assay or kit ABC kit PK-7200 Vector laboratories Commercial assay or kit MojoSort Mouse naive CD4 T Cell Isolation Kit 480031 Biolegend Chemical compound, drug Diethly Fumerate Sigma Aldrich D95654 Chemical compound, drug N-Acetyl-L-cysteine Sigma-Aldrich A7250 Chemical compound, drug Tamofixen Sigma-Aldrich T5648 Chemical compound, drug 4-hydroxytamoxifen Sigma H7904 Chemical compound, drug Dimethy a-keto glutarate/aKG Sigma-Aldrich 34963–1 Chemical compound, drug Hypoxathine Sigma-Aldrich H9377 Chemical compound, drug Thymidine Sigma T9250 Chemical compound, drug H2O2 Sigma-Aldrich 7722-84-1 Chemical compound, drug carboxyfluorescein diacetate succinimidyl ester(CFSE) Invitrogen C1157 Chemical compound, drug DM-H2DCFDA Invitrogen C6827 Chemical compound, drug DAB Vector Laboratories SK-4100 Chemical compound, drug Monobromobimane Invitrogen M1378 Chemical compound, drug 7-aminoactinomycin D(7AAD) Biolegend 420404 Chemical compound, drug Pertussis toxin 181 List Biological Laboratories Chemical compound, drug Mycobacterium tuberculosum 231141 Difco Chemical compound, drug Incomplete Freund’s Adjuvant 263910 Difco Chemical compound, drug [U-14C]-glutamine MC 1124 Moravek Chemical compound, drug [2–14C]-pyruvate ARC 0222 American Radiolabeled Chemicals Continued on next page Lian et al. eLife 2018;7:e36158. .. DOI: https://doi.org/10.7554/eLife.36158 18 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Cell Stimulation Cocktail (plus protein transport inhibitors) (500X) 00-4975-93 eBioscience Chemical compound, drug Iscove’s Modified Dulbecco’s Media - Glucose free conditional medium ME17058P1 Thermo Fisher Scientific Chemical compound, drug Iscove’s Modified Dulbecco’s Media - without L-glutamine 12–726 f Lonza Chemical compound, drug RPMI 1640 Medium, No Glucose 11-879-020 Gibco Chemical compound, drug Hyclone RPMI 1640 Medium, no glutamine sh30096.10 Thermo Fisher Scientific Chemical compound, drug U-13C6-glutamine CNLM-1275–0.1 Cambridge Isotope Lab Chemical compound, drug 6-Diazo-5-oxo-L -norleucine D2141-5MG Sigma-aldrich Chemical compound, drug Bis-2(5-phenylacetamido -1,3,4-thiadiazol-2-yl) ethyl sulfide (BPTES) SML0601 Sigma-aldrich Chemical compound, drug CB-839 22038 Cayman Software, algorithm Graphpad Prism RRID:SCR_002798 Software, algorithm FlowJo RRID:SCR_008520

    Article Title: A beneficial environment promotes immune resilience through epigenetic regulation.
    Article Snippet: The cells were first incubated with anti- CD16/32 blocking antibody (Invitrogen, no. 23348094) and then stained with Live/Dead cell viability dye (Zombie Aqua or Fixable Viability Stain 620) and antibodies for surface markers (table S1). .. The cells were fixed and permeabilized using the Foxp3/Transcription Factor Staining Buffer Set (Miltenyi Biotec, 130- 093- 142) and subsequently stained with intracellular markers (table S1). .. The samples were analyzed using the BD FACSymphony A1 Cell Analyzer running BD FACSDiva v8.

    Article Title: Innate lymphoid cells integrate sensing and plasticity to control fungal infections
    Article Snippet: Cat# 65-0840-90 Cyanine5 Streptavidin Biolegend Cat#405209 APC-Fire750 Streptavidin Biolegend Cat#405250 Streptavidin-DyLight 488 (currently marketed as Alexa Fluor 488) Jackson ImmunoResearch Cat#016-540-084 7-AAD Viability Staining Solution Biolegend Cat#420403 Apotracker Green Biolegend Cat#427401 Zombie Aqua Fixable Viability Kit Biolegend Cat#423102 Zombie NIR Fixable Viability Kit Biolegend Cat#423105 Zombie Violet Fixable Viability Kit Biolegend Cat#423113 Collagenase II Gibco; Fisher Scientific Cat# 17101015 DNAse I Sigma-Aldrich Cat#10104159001 Percoll GE-Healthcare Cat#GE17-0891-01 Recombinant Mouse IL-2 Biolegend Cat#575404 Recombinant Mouse IL-7 Biolegend Cat#577802 Recombinant Mouse SCF Miltenyi Cat#130-101-693 Recombinant Mouse IL-1β MedchemExpress Cat# MCE-HY-P7073A-2μg Recombinant Mouse IL-23 Biolegend Cat#589002 Recombinant Mouse IL-17C BioTechne Cat#2306-ML-025 Recombinant Rat/Mouse TGFβ1 MedchemExpress MCE-HY-P7117-2μg Brefeldin A Biolegend Cat#420601 Phorbol myristate acetate (PMA) Sigma-Aldrich Cat#P1585 Ionomycin Sigma-Aldrich Cat#IO634 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D2438 Zymosan Sigma-Aldrich Cat#Z4250 Curdlan Invivogen Cat#tlrl-cura Laminarin Invivogen Cat#tlrl-lam Chitin Wagener et al.115 N/A Dynasore hydrate Sigma-Aldrich Cat#D7693 R406 (Syk Inhibitor) Selleckchem Cat#S2194 α-D-Mannan Sigma-Aldrich Cat#M7504 Ketamin: Ketasol Livisto GTIN# 04050478000336 Xylazine: Sedaxylan Dechra GTIN# 08714225157464 Intracellular Staining Permeabilization Wash Buffer (10X) Biolegend Cat#421002 Fixation Buffer Biolegend Cat#420801 (Continued on next page) 22 Cell Reports 45, 117140, April 28, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Red Blood Cell Lysis Buffer (10X) Biolegend Cat#420302 True-Phos Perm Buffer Biolegend Cat#425401 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich Cat#8537 Hanks’ Balanced Salt solution Sigma-Aldrich Cat#8264 IMDM (Iscove’s Modified Dulbecco’s Medium) Lonza Cat#12-722F RPMI 1640 Medium Gibco; Fisher Scientific Cat#21875091 GlutaMAX Supplement Gibco; Fisher Scientific Cat#35050061 HEPES (1M) Gibco; Fisher Scientific Cat#15630080 Sodium pyruvate solution,100 mM Sigma-Aldrich Cat#S8636 MEM Non-essential Amino Acid Solution (100X) Sigma-Aldrich Cat#M7145 RNAlater Sigma-Aldrich Cat#R0901 z-IETD-FMK MedchemExpress Cat#MCE-HY-101297-1mg Necrostatin-1 MedchemExpress Cat#HY-15760 Ultra PureTM Distilled DNAse/RNAse free Water Invitrogen; Fisher Scientific Cat#10977049 Commercial assays Lineage cell depletion kit, mouse Miltenyi Cat#130-090-858 Foxp3/Transcription Factor Staining Buffer Set-1 kit eBioscience, Fisher Scient. .. Cat#00-5523-00 System for Reverse Transcription Using AMV RT Promega Cat#A3500 SsoAdvanced Universal SYBR Green Supermix Biorad Cat#1725271 QIAGEN RNeasy Plus Micro Kit Quiagen Cat#74034 Monarch Spin RNA Cleanup Kit (10 μg) New England Biolabs Cat#T2030L Deposited data Mass Spectrometry of culture supernatants (ILC-Cgl interaction) ProteomeXchange Consortium111 PRIDE:PXD061271 Pulmonary ILC Sequencing (Smart-Seq2) GEO-database GEO:GSE293220 RNA-Sequencing of infected lung tissues after ILC-transfer GEO-database GEO:GSE293054 Experimental models cell lines Feeder cells: OP9-DL1 Gift of Meinrad Busslinger Schmitt & Zúñiga-Pflücker116 Experimental murine models, strains Mouse: C57BL/6J mice Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 Mouse: Rag1− /− : B6.129S7-Rag1tm1Mom/J Jackson Laboratory RRID:IMSR_JAX:002096 Mouse: Rag2− /− Il2rg− /− Cao et al.117 Veronika Sexl Mouse: IL17A-IRES-GFP-KI reporter: C57BL/6-Il17atm1Bcgen/J Jackson Laboratory RRID: IMSR_JAX:018472 Mouse: Tec− /− Rag1− /− IL-17AeGFP: C57BL/6Il17atm1Bcgen/J x Tectm1Welm x B6.129S7-Rag1tm1Mom/J This study N/A Mouse: Dectin-1− /− : B6.129S6-Clec7atm1Gdb/J Taylor et al.118 RRID:IMSR_JAX:012337 Mouse: Dectin-2− /− : Clec4ntm1Yiw Saijo et al.119 MGI:4459637 Mouse: Tlr2/− : Tlr2tm1Aki Takeuchi et al.120 MGI:2178675 Mouse: Tlr4− /− : Tlr4tm1Aki Hashino et al.121 MGI:1860885 Mouse: Tec− /− : Tectm1Welm Ellmeier et al.34 MGI:2450883 Oligonucleotides m-Eef1a forward/reverse (5′-3′): ACGAGGCAATGTTG CTGGTGAC/GTGTGACAATCCAGAACAGGAGC Origene Cat#MP204369; GenBank:NM_010106 m-Tgfb1 forward/reverse (5′-3′): TGACGTCACTGGA GTTGTACGG/GGTTCATGTCATGGATGGTGC N/A GenBank:NM_011577.2 m-Il1b forward/reverse (5′-3′): (CCAACAAGTGATAT TCTCCATGAG/TCTTTCATTACACAGGACAGGT) N/A GenBank:NM_008361.4 (Continued on next page) Cell Reports 45, 117140, April 28, 2026 23

    Transfection:

    Article Title: DNA architectural protein CTCF facilitates subset-specific chromatin interactions to limit the formation of memory CD8 + T cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER AMPure XP beads Beckman Coulter Cat#A63880 Brilliant II Sybr Green Agilent Technologies Cat#600828 Phenol-Chloroform Invitrogen Cat#15593049 DPBS Gibco Cat#14190250 Concanavalin A beads Bangs Laboratories Cat#BP531 CaCl2 Fisher Scientific Cat# BP510-500 RNase A Qiagen Cat#19101 Glycogen Millipore Sigma Cat#10901393001 SDS Fisher Scientific Cat#BP166-100 Proteinase K Fisher Scientific Cat#BP1700-50 Ethanol Sigma-Aldrich Cat#E7023-500ML Maxtract High-density tubes Qiagen Cat#129046 KCl Sigma-Aldrich Cat#P3911-25G Spermidine Sigma-Aldrich Cat#S2501-5G PEG 8000 Sigma-Aldrich Cat#202452-500G NaCl Thermo Fisher Scientific Cat# S271-500 EDTA Thermo Fisher Scientific Cat#17892 EGTA Sigma Aldrich Cat#E3889 Triton X-100 Sigma Aldrich Cat#X100-5ML cOmplete , EDTA-free Protease Inhibitor Cocktail Millipore Sigma Cat#5056489001 Formaldehyde Sigma-Aldrich Cat# FP8775 Glycine Thermo Fisher Scientific Cat# BP381-5 Agarose Thermo Fisher Scientific Cat# BP1356-500 Benzamidine Sigma-Aldrich Cat#B6506-5G Proteinase Inhibitor Cocktail Calbiochem Cat#539137-10VL Dynabeads Protein G Invitrogen Cat#10003D Tris base Thermo Fisher Scientific Cat# BP152-5 NP-40 Sigma-Aldrich Cat# 11332473001 NaDOC Sigma-Aldrich Cat# D6750-25G Ultrapure Water Fisher Scientific Cat# 10-977-015 Quick Ligation Kit New England Bioscience Cat# M2200S Quick Ligase New England Bioscience Cat#E7337A Nanosep MF Filter Tube VWR Cat#29300-642 Sybr Gold Invitrogen Cat#S11494 40% Polyacrylamide Biorad Cat# 161-0146 Ammonium Persulfate VWR Cat# EM-2300 TEMED VWR Cat# PAV3161 6x loading dye Thermo Fisher Scientific Cat# R0631 NaOAC Thermo Fisher Scientific Cat# S25531 Glycoblue Invitrogen Cat# AM9515 NEBNext High Fidelity 2X PCR Master Mix New England Bioscience Cat# M0541L MboI-HF enzyme New England Bioscience Cat#R0147 Biotin-14-dATP Life Technologies Cat#19523-016 DNA Polymerase (Klenow) New England Bioscience Cat#M0210 10x NEB buffer New England Bioscience Cat#B0202 T4 DNA Ligase New England Bioscience Cat#M0202 Dynabeads Streptavidin Life Technologies Cat#65602 (Continued on next page) Immunity 56, 959–978.e1–e10, May 9, 2023 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Klenow exo minus New England Bioscience Cat#M0212 NEBNext Ultra II Q5 Master Mix New England Bioscience Cat#M0544S Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#554714 Foxp3/Transcription Factor Staining Buffer Set eBiosciences Cat#00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#MIR 2300 LS Columns Miltenyi Biotec Cat#130-042 APC BrdU Kit BD Biosciences Cat#557892; RRID:AB_2861367 FlexiGene Kit Qiagen Cat#51206 Superscript II Thermo Fisher Scientific Cat#18-064-014 Zymo DNA Clean&Concentrator Zymo Research Cat#D4030 End-it DNA End-repair Kit Lucigen Cat#ER81050 NEB Library Index New England Biosciences Cat#E7600S Qubit dsDNA HS Assay Thermo Fisher Scientific Cat#Q32851 Deposited data CD8+ T cell histone modifications ChIP Yu et al.14 GSE89036 Patient RNA Seq Gregor et al.47; Konrad et al.48 GSE46833 Tbet ChIP-Seq Dominguez et al.41 PRJNA287664 Hi-C Sequencing This paper GSE205081 Naive and Memory Hi-C Sequencing Russ et al.32 GSE225885 CTCF knockdown RNA Sequencing This paper GSE205079 CTCF ChIP-Seq This paper GSE205077 Input ChIP-Seq Yu et al.14 GSE89036 CTCF Cut&Run This paper GSE205077 CTCF knockdown Cut&Run This paper GSE205077 CTCF knockdown ATAC This paper GSE205076 Experimental models: Cell lines B16-GP33-41 Dr. A. Lamarre, INRS-institut Armand-Frappier N/A PLAT-E Cell Biolabs Cat#RV-101; RRID: CCL_B488 Experimental models: Organisms/strains P14 (B6.Cg-Tcratm1Mom Tg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Cat#037394-JAX; RRID: MMRRC_037394-JAX OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID: IMRS_JAX:003831 CD45.2 (C57BL/6J) The Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Cat#002014; RRID: IMSR_JAX:002014 CD45.1.2 Bred in-house N/A Oligonucleotides CTCF- forward for qPCR: 5’- AGTGAAAATGCTGAGCCGGA-3’ IDT N/A CTCF-reverse for qPCR: 5’- ATGATGGCTGTTGGCTGGTT-3’ IDT N/A Hprt-forward for qPCR: 5’- GGCCAGACTTTGTTGGATTT-3’ IDT N/A Hprt-reverse for qPCR: 5’- CAACTTGCGCTCATCT-3’. .. IDT N/A Gapdh-forward for qPCR:5’AGGTCGGTGTGAACGGATTTG-3’ IDT N/A (Continued on next page) e4 Immunity 56, 959–978.e1–e10, May 9, 2023

    Chromatin Immunoprecipitation:

    Article Title: DNA architectural protein CTCF facilitates subset-specific chromatin interactions to limit the formation of memory CD8 + T cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER AMPure XP beads Beckman Coulter Cat#A63880 Brilliant II Sybr Green Agilent Technologies Cat#600828 Phenol-Chloroform Invitrogen Cat#15593049 DPBS Gibco Cat#14190250 Concanavalin A beads Bangs Laboratories Cat#BP531 CaCl2 Fisher Scientific Cat# BP510-500 RNase A Qiagen Cat#19101 Glycogen Millipore Sigma Cat#10901393001 SDS Fisher Scientific Cat#BP166-100 Proteinase K Fisher Scientific Cat#BP1700-50 Ethanol Sigma-Aldrich Cat#E7023-500ML Maxtract High-density tubes Qiagen Cat#129046 KCl Sigma-Aldrich Cat#P3911-25G Spermidine Sigma-Aldrich Cat#S2501-5G PEG 8000 Sigma-Aldrich Cat#202452-500G NaCl Thermo Fisher Scientific Cat# S271-500 EDTA Thermo Fisher Scientific Cat#17892 EGTA Sigma Aldrich Cat#E3889 Triton X-100 Sigma Aldrich Cat#X100-5ML cOmplete , EDTA-free Protease Inhibitor Cocktail Millipore Sigma Cat#5056489001 Formaldehyde Sigma-Aldrich Cat# FP8775 Glycine Thermo Fisher Scientific Cat# BP381-5 Agarose Thermo Fisher Scientific Cat# BP1356-500 Benzamidine Sigma-Aldrich Cat#B6506-5G Proteinase Inhibitor Cocktail Calbiochem Cat#539137-10VL Dynabeads Protein G Invitrogen Cat#10003D Tris base Thermo Fisher Scientific Cat# BP152-5 NP-40 Sigma-Aldrich Cat# 11332473001 NaDOC Sigma-Aldrich Cat# D6750-25G Ultrapure Water Fisher Scientific Cat# 10-977-015 Quick Ligation Kit New England Bioscience Cat# M2200S Quick Ligase New England Bioscience Cat#E7337A Nanosep MF Filter Tube VWR Cat#29300-642 Sybr Gold Invitrogen Cat#S11494 40% Polyacrylamide Biorad Cat# 161-0146 Ammonium Persulfate VWR Cat# EM-2300 TEMED VWR Cat# PAV3161 6x loading dye Thermo Fisher Scientific Cat# R0631 NaOAC Thermo Fisher Scientific Cat# S25531 Glycoblue Invitrogen Cat# AM9515 NEBNext High Fidelity 2X PCR Master Mix New England Bioscience Cat# M0541L MboI-HF enzyme New England Bioscience Cat#R0147 Biotin-14-dATP Life Technologies Cat#19523-016 DNA Polymerase (Klenow) New England Bioscience Cat#M0210 10x NEB buffer New England Bioscience Cat#B0202 T4 DNA Ligase New England Bioscience Cat#M0202 Dynabeads Streptavidin Life Technologies Cat#65602 (Continued on next page) Immunity 56, 959–978.e1–e10, May 9, 2023 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Klenow exo minus New England Bioscience Cat#M0212 NEBNext Ultra II Q5 Master Mix New England Bioscience Cat#M0544S Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#554714 Foxp3/Transcription Factor Staining Buffer Set eBiosciences Cat#00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#MIR 2300 LS Columns Miltenyi Biotec Cat#130-042 APC BrdU Kit BD Biosciences Cat#557892; RRID:AB_2861367 FlexiGene Kit Qiagen Cat#51206 Superscript II Thermo Fisher Scientific Cat#18-064-014 Zymo DNA Clean&Concentrator Zymo Research Cat#D4030 End-it DNA End-repair Kit Lucigen Cat#ER81050 NEB Library Index New England Biosciences Cat#E7600S Qubit dsDNA HS Assay Thermo Fisher Scientific Cat#Q32851 Deposited data CD8+ T cell histone modifications ChIP Yu et al.14 GSE89036 Patient RNA Seq Gregor et al.47; Konrad et al.48 GSE46833 Tbet ChIP-Seq Dominguez et al.41 PRJNA287664 Hi-C Sequencing This paper GSE205081 Naive and Memory Hi-C Sequencing Russ et al.32 GSE225885 CTCF knockdown RNA Sequencing This paper GSE205079 CTCF ChIP-Seq This paper GSE205077 Input ChIP-Seq Yu et al.14 GSE89036 CTCF Cut&Run This paper GSE205077 CTCF knockdown Cut&Run This paper GSE205077 CTCF knockdown ATAC This paper GSE205076 Experimental models: Cell lines B16-GP33-41 Dr. A. Lamarre, INRS-institut Armand-Frappier N/A PLAT-E Cell Biolabs Cat#RV-101; RRID: CCL_B488 Experimental models: Organisms/strains P14 (B6.Cg-Tcratm1Mom Tg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Cat#037394-JAX; RRID: MMRRC_037394-JAX OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID: IMRS_JAX:003831 CD45.2 (C57BL/6J) The Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Cat#002014; RRID: IMSR_JAX:002014 CD45.1.2 Bred in-house N/A Oligonucleotides CTCF- forward for qPCR: 5’- AGTGAAAATGCTGAGCCGGA-3’ IDT N/A CTCF-reverse for qPCR: 5’- ATGATGGCTGTTGGCTGGTT-3’ IDT N/A Hprt-forward for qPCR: 5’- GGCCAGACTTTGTTGGATTT-3’ IDT N/A Hprt-reverse for qPCR: 5’- CAACTTGCGCTCATCT-3’. .. IDT N/A Gapdh-forward for qPCR:5’AGGTCGGTGTGAACGGATTTG-3’ IDT N/A (Continued on next page) e4 Immunity 56, 959–978.e1–e10, May 9, 2023

    RNA Sequencing:

    Article Title: DNA architectural protein CTCF facilitates subset-specific chromatin interactions to limit the formation of memory CD8 + T cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER AMPure XP beads Beckman Coulter Cat#A63880 Brilliant II Sybr Green Agilent Technologies Cat#600828 Phenol-Chloroform Invitrogen Cat#15593049 DPBS Gibco Cat#14190250 Concanavalin A beads Bangs Laboratories Cat#BP531 CaCl2 Fisher Scientific Cat# BP510-500 RNase A Qiagen Cat#19101 Glycogen Millipore Sigma Cat#10901393001 SDS Fisher Scientific Cat#BP166-100 Proteinase K Fisher Scientific Cat#BP1700-50 Ethanol Sigma-Aldrich Cat#E7023-500ML Maxtract High-density tubes Qiagen Cat#129046 KCl Sigma-Aldrich Cat#P3911-25G Spermidine Sigma-Aldrich Cat#S2501-5G PEG 8000 Sigma-Aldrich Cat#202452-500G NaCl Thermo Fisher Scientific Cat# S271-500 EDTA Thermo Fisher Scientific Cat#17892 EGTA Sigma Aldrich Cat#E3889 Triton X-100 Sigma Aldrich Cat#X100-5ML cOmplete , EDTA-free Protease Inhibitor Cocktail Millipore Sigma Cat#5056489001 Formaldehyde Sigma-Aldrich Cat# FP8775 Glycine Thermo Fisher Scientific Cat# BP381-5 Agarose Thermo Fisher Scientific Cat# BP1356-500 Benzamidine Sigma-Aldrich Cat#B6506-5G Proteinase Inhibitor Cocktail Calbiochem Cat#539137-10VL Dynabeads Protein G Invitrogen Cat#10003D Tris base Thermo Fisher Scientific Cat# BP152-5 NP-40 Sigma-Aldrich Cat# 11332473001 NaDOC Sigma-Aldrich Cat# D6750-25G Ultrapure Water Fisher Scientific Cat# 10-977-015 Quick Ligation Kit New England Bioscience Cat# M2200S Quick Ligase New England Bioscience Cat#E7337A Nanosep MF Filter Tube VWR Cat#29300-642 Sybr Gold Invitrogen Cat#S11494 40% Polyacrylamide Biorad Cat# 161-0146 Ammonium Persulfate VWR Cat# EM-2300 TEMED VWR Cat# PAV3161 6x loading dye Thermo Fisher Scientific Cat# R0631 NaOAC Thermo Fisher Scientific Cat# S25531 Glycoblue Invitrogen Cat# AM9515 NEBNext High Fidelity 2X PCR Master Mix New England Bioscience Cat# M0541L MboI-HF enzyme New England Bioscience Cat#R0147 Biotin-14-dATP Life Technologies Cat#19523-016 DNA Polymerase (Klenow) New England Bioscience Cat#M0210 10x NEB buffer New England Bioscience Cat#B0202 T4 DNA Ligase New England Bioscience Cat#M0202 Dynabeads Streptavidin Life Technologies Cat#65602 (Continued on next page) Immunity 56, 959–978.e1–e10, May 9, 2023 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Klenow exo minus New England Bioscience Cat#M0212 NEBNext Ultra II Q5 Master Mix New England Bioscience Cat#M0544S Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#554714 Foxp3/Transcription Factor Staining Buffer Set eBiosciences Cat#00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#MIR 2300 LS Columns Miltenyi Biotec Cat#130-042 APC BrdU Kit BD Biosciences Cat#557892; RRID:AB_2861367 FlexiGene Kit Qiagen Cat#51206 Superscript II Thermo Fisher Scientific Cat#18-064-014 Zymo DNA Clean&Concentrator Zymo Research Cat#D4030 End-it DNA End-repair Kit Lucigen Cat#ER81050 NEB Library Index New England Biosciences Cat#E7600S Qubit dsDNA HS Assay Thermo Fisher Scientific Cat#Q32851 Deposited data CD8+ T cell histone modifications ChIP Yu et al.14 GSE89036 Patient RNA Seq Gregor et al.47; Konrad et al.48 GSE46833 Tbet ChIP-Seq Dominguez et al.41 PRJNA287664 Hi-C Sequencing This paper GSE205081 Naive and Memory Hi-C Sequencing Russ et al.32 GSE225885 CTCF knockdown RNA Sequencing This paper GSE205079 CTCF ChIP-Seq This paper GSE205077 Input ChIP-Seq Yu et al.14 GSE89036 CTCF Cut&Run This paper GSE205077 CTCF knockdown Cut&Run This paper GSE205077 CTCF knockdown ATAC This paper GSE205076 Experimental models: Cell lines B16-GP33-41 Dr. A. Lamarre, INRS-institut Armand-Frappier N/A PLAT-E Cell Biolabs Cat#RV-101; RRID: CCL_B488 Experimental models: Organisms/strains P14 (B6.Cg-Tcratm1Mom Tg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Cat#037394-JAX; RRID: MMRRC_037394-JAX OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID: IMRS_JAX:003831 CD45.2 (C57BL/6J) The Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Cat#002014; RRID: IMSR_JAX:002014 CD45.1.2 Bred in-house N/A Oligonucleotides CTCF- forward for qPCR: 5’- AGTGAAAATGCTGAGCCGGA-3’ IDT N/A CTCF-reverse for qPCR: 5’- ATGATGGCTGTTGGCTGGTT-3’ IDT N/A Hprt-forward for qPCR: 5’- GGCCAGACTTTGTTGGATTT-3’ IDT N/A Hprt-reverse for qPCR: 5’- CAACTTGCGCTCATCT-3’. .. IDT N/A Gapdh-forward for qPCR:5’AGGTCGGTGTGAACGGATTTG-3’ IDT N/A (Continued on next page) e4 Immunity 56, 959–978.e1–e10, May 9, 2023

    Hi-C:

    Article Title: DNA architectural protein CTCF facilitates subset-specific chromatin interactions to limit the formation of memory CD8 + T cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER AMPure XP beads Beckman Coulter Cat#A63880 Brilliant II Sybr Green Agilent Technologies Cat#600828 Phenol-Chloroform Invitrogen Cat#15593049 DPBS Gibco Cat#14190250 Concanavalin A beads Bangs Laboratories Cat#BP531 CaCl2 Fisher Scientific Cat# BP510-500 RNase A Qiagen Cat#19101 Glycogen Millipore Sigma Cat#10901393001 SDS Fisher Scientific Cat#BP166-100 Proteinase K Fisher Scientific Cat#BP1700-50 Ethanol Sigma-Aldrich Cat#E7023-500ML Maxtract High-density tubes Qiagen Cat#129046 KCl Sigma-Aldrich Cat#P3911-25G Spermidine Sigma-Aldrich Cat#S2501-5G PEG 8000 Sigma-Aldrich Cat#202452-500G NaCl Thermo Fisher Scientific Cat# S271-500 EDTA Thermo Fisher Scientific Cat#17892 EGTA Sigma Aldrich Cat#E3889 Triton X-100 Sigma Aldrich Cat#X100-5ML cOmplete , EDTA-free Protease Inhibitor Cocktail Millipore Sigma Cat#5056489001 Formaldehyde Sigma-Aldrich Cat# FP8775 Glycine Thermo Fisher Scientific Cat# BP381-5 Agarose Thermo Fisher Scientific Cat# BP1356-500 Benzamidine Sigma-Aldrich Cat#B6506-5G Proteinase Inhibitor Cocktail Calbiochem Cat#539137-10VL Dynabeads Protein G Invitrogen Cat#10003D Tris base Thermo Fisher Scientific Cat# BP152-5 NP-40 Sigma-Aldrich Cat# 11332473001 NaDOC Sigma-Aldrich Cat# D6750-25G Ultrapure Water Fisher Scientific Cat# 10-977-015 Quick Ligation Kit New England Bioscience Cat# M2200S Quick Ligase New England Bioscience Cat#E7337A Nanosep MF Filter Tube VWR Cat#29300-642 Sybr Gold Invitrogen Cat#S11494 40% Polyacrylamide Biorad Cat# 161-0146 Ammonium Persulfate VWR Cat# EM-2300 TEMED VWR Cat# PAV3161 6x loading dye Thermo Fisher Scientific Cat# R0631 NaOAC Thermo Fisher Scientific Cat# S25531 Glycoblue Invitrogen Cat# AM9515 NEBNext High Fidelity 2X PCR Master Mix New England Bioscience Cat# M0541L MboI-HF enzyme New England Bioscience Cat#R0147 Biotin-14-dATP Life Technologies Cat#19523-016 DNA Polymerase (Klenow) New England Bioscience Cat#M0210 10x NEB buffer New England Bioscience Cat#B0202 T4 DNA Ligase New England Bioscience Cat#M0202 Dynabeads Streptavidin Life Technologies Cat#65602 (Continued on next page) Immunity 56, 959–978.e1–e10, May 9, 2023 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Klenow exo minus New England Bioscience Cat#M0212 NEBNext Ultra II Q5 Master Mix New England Bioscience Cat#M0544S Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#554714 Foxp3/Transcription Factor Staining Buffer Set eBiosciences Cat#00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#MIR 2300 LS Columns Miltenyi Biotec Cat#130-042 APC BrdU Kit BD Biosciences Cat#557892; RRID:AB_2861367 FlexiGene Kit Qiagen Cat#51206 Superscript II Thermo Fisher Scientific Cat#18-064-014 Zymo DNA Clean&Concentrator Zymo Research Cat#D4030 End-it DNA End-repair Kit Lucigen Cat#ER81050 NEB Library Index New England Biosciences Cat#E7600S Qubit dsDNA HS Assay Thermo Fisher Scientific Cat#Q32851 Deposited data CD8+ T cell histone modifications ChIP Yu et al.14 GSE89036 Patient RNA Seq Gregor et al.47; Konrad et al.48 GSE46833 Tbet ChIP-Seq Dominguez et al.41 PRJNA287664 Hi-C Sequencing This paper GSE205081 Naive and Memory Hi-C Sequencing Russ et al.32 GSE225885 CTCF knockdown RNA Sequencing This paper GSE205079 CTCF ChIP-Seq This paper GSE205077 Input ChIP-Seq Yu et al.14 GSE89036 CTCF Cut&Run This paper GSE205077 CTCF knockdown Cut&Run This paper GSE205077 CTCF knockdown ATAC This paper GSE205076 Experimental models: Cell lines B16-GP33-41 Dr. A. Lamarre, INRS-institut Armand-Frappier N/A PLAT-E Cell Biolabs Cat#RV-101; RRID: CCL_B488 Experimental models: Organisms/strains P14 (B6.Cg-Tcratm1Mom Tg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Cat#037394-JAX; RRID: MMRRC_037394-JAX OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID: IMRS_JAX:003831 CD45.2 (C57BL/6J) The Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Cat#002014; RRID: IMSR_JAX:002014 CD45.1.2 Bred in-house N/A Oligonucleotides CTCF- forward for qPCR: 5’- AGTGAAAATGCTGAGCCGGA-3’ IDT N/A CTCF-reverse for qPCR: 5’- ATGATGGCTGTTGGCTGGTT-3’ IDT N/A Hprt-forward for qPCR: 5’- GGCCAGACTTTGTTGGATTT-3’ IDT N/A Hprt-reverse for qPCR: 5’- CAACTTGCGCTCATCT-3’. .. IDT N/A Gapdh-forward for qPCR:5’AGGTCGGTGTGAACGGATTTG-3’ IDT N/A (Continued on next page) e4 Immunity 56, 959–978.e1–e10, May 9, 2023

    Sequencing:

    Article Title: DNA architectural protein CTCF facilitates subset-specific chromatin interactions to limit the formation of memory CD8 + T cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER AMPure XP beads Beckman Coulter Cat#A63880 Brilliant II Sybr Green Agilent Technologies Cat#600828 Phenol-Chloroform Invitrogen Cat#15593049 DPBS Gibco Cat#14190250 Concanavalin A beads Bangs Laboratories Cat#BP531 CaCl2 Fisher Scientific Cat# BP510-500 RNase A Qiagen Cat#19101 Glycogen Millipore Sigma Cat#10901393001 SDS Fisher Scientific Cat#BP166-100 Proteinase K Fisher Scientific Cat#BP1700-50 Ethanol Sigma-Aldrich Cat#E7023-500ML Maxtract High-density tubes Qiagen Cat#129046 KCl Sigma-Aldrich Cat#P3911-25G Spermidine Sigma-Aldrich Cat#S2501-5G PEG 8000 Sigma-Aldrich Cat#202452-500G NaCl Thermo Fisher Scientific Cat# S271-500 EDTA Thermo Fisher Scientific Cat#17892 EGTA Sigma Aldrich Cat#E3889 Triton X-100 Sigma Aldrich Cat#X100-5ML cOmplete , EDTA-free Protease Inhibitor Cocktail Millipore Sigma Cat#5056489001 Formaldehyde Sigma-Aldrich Cat# FP8775 Glycine Thermo Fisher Scientific Cat# BP381-5 Agarose Thermo Fisher Scientific Cat# BP1356-500 Benzamidine Sigma-Aldrich Cat#B6506-5G Proteinase Inhibitor Cocktail Calbiochem Cat#539137-10VL Dynabeads Protein G Invitrogen Cat#10003D Tris base Thermo Fisher Scientific Cat# BP152-5 NP-40 Sigma-Aldrich Cat# 11332473001 NaDOC Sigma-Aldrich Cat# D6750-25G Ultrapure Water Fisher Scientific Cat# 10-977-015 Quick Ligation Kit New England Bioscience Cat# M2200S Quick Ligase New England Bioscience Cat#E7337A Nanosep MF Filter Tube VWR Cat#29300-642 Sybr Gold Invitrogen Cat#S11494 40% Polyacrylamide Biorad Cat# 161-0146 Ammonium Persulfate VWR Cat# EM-2300 TEMED VWR Cat# PAV3161 6x loading dye Thermo Fisher Scientific Cat# R0631 NaOAC Thermo Fisher Scientific Cat# S25531 Glycoblue Invitrogen Cat# AM9515 NEBNext High Fidelity 2X PCR Master Mix New England Bioscience Cat# M0541L MboI-HF enzyme New England Bioscience Cat#R0147 Biotin-14-dATP Life Technologies Cat#19523-016 DNA Polymerase (Klenow) New England Bioscience Cat#M0210 10x NEB buffer New England Bioscience Cat#B0202 T4 DNA Ligase New England Bioscience Cat#M0202 Dynabeads Streptavidin Life Technologies Cat#65602 (Continued on next page) Immunity 56, 959–978.e1–e10, May 9, 2023 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Klenow exo minus New England Bioscience Cat#M0212 NEBNext Ultra II Q5 Master Mix New England Bioscience Cat#M0544S Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#554714 Foxp3/Transcription Factor Staining Buffer Set eBiosciences Cat#00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#MIR 2300 LS Columns Miltenyi Biotec Cat#130-042 APC BrdU Kit BD Biosciences Cat#557892; RRID:AB_2861367 FlexiGene Kit Qiagen Cat#51206 Superscript II Thermo Fisher Scientific Cat#18-064-014 Zymo DNA Clean&Concentrator Zymo Research Cat#D4030 End-it DNA End-repair Kit Lucigen Cat#ER81050 NEB Library Index New England Biosciences Cat#E7600S Qubit dsDNA HS Assay Thermo Fisher Scientific Cat#Q32851 Deposited data CD8+ T cell histone modifications ChIP Yu et al.14 GSE89036 Patient RNA Seq Gregor et al.47; Konrad et al.48 GSE46833 Tbet ChIP-Seq Dominguez et al.41 PRJNA287664 Hi-C Sequencing This paper GSE205081 Naive and Memory Hi-C Sequencing Russ et al.32 GSE225885 CTCF knockdown RNA Sequencing This paper GSE205079 CTCF ChIP-Seq This paper GSE205077 Input ChIP-Seq Yu et al.14 GSE89036 CTCF Cut&Run This paper GSE205077 CTCF knockdown Cut&Run This paper GSE205077 CTCF knockdown ATAC This paper GSE205076 Experimental models: Cell lines B16-GP33-41 Dr. A. Lamarre, INRS-institut Armand-Frappier N/A PLAT-E Cell Biolabs Cat#RV-101; RRID: CCL_B488 Experimental models: Organisms/strains P14 (B6.Cg-Tcratm1Mom Tg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Cat#037394-JAX; RRID: MMRRC_037394-JAX OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID: IMRS_JAX:003831 CD45.2 (C57BL/6J) The Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Cat#002014; RRID: IMSR_JAX:002014 CD45.1.2 Bred in-house N/A Oligonucleotides CTCF- forward for qPCR: 5’- AGTGAAAATGCTGAGCCGGA-3’ IDT N/A CTCF-reverse for qPCR: 5’- ATGATGGCTGTTGGCTGGTT-3’ IDT N/A Hprt-forward for qPCR: 5’- GGCCAGACTTTGTTGGATTT-3’ IDT N/A Hprt-reverse for qPCR: 5’- CAACTTGCGCTCATCT-3’. .. IDT N/A Gapdh-forward for qPCR:5’AGGTCGGTGTGAACGGATTTG-3’ IDT N/A (Continued on next page) e4 Immunity 56, 959–978.e1–e10, May 9, 2023

    Knockdown:

    Article Title: DNA architectural protein CTCF facilitates subset-specific chromatin interactions to limit the formation of memory CD8 + T cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER AMPure XP beads Beckman Coulter Cat#A63880 Brilliant II Sybr Green Agilent Technologies Cat#600828 Phenol-Chloroform Invitrogen Cat#15593049 DPBS Gibco Cat#14190250 Concanavalin A beads Bangs Laboratories Cat#BP531 CaCl2 Fisher Scientific Cat# BP510-500 RNase A Qiagen Cat#19101 Glycogen Millipore Sigma Cat#10901393001 SDS Fisher Scientific Cat#BP166-100 Proteinase K Fisher Scientific Cat#BP1700-50 Ethanol Sigma-Aldrich Cat#E7023-500ML Maxtract High-density tubes Qiagen Cat#129046 KCl Sigma-Aldrich Cat#P3911-25G Spermidine Sigma-Aldrich Cat#S2501-5G PEG 8000 Sigma-Aldrich Cat#202452-500G NaCl Thermo Fisher Scientific Cat# S271-500 EDTA Thermo Fisher Scientific Cat#17892 EGTA Sigma Aldrich Cat#E3889 Triton X-100 Sigma Aldrich Cat#X100-5ML cOmplete , EDTA-free Protease Inhibitor Cocktail Millipore Sigma Cat#5056489001 Formaldehyde Sigma-Aldrich Cat# FP8775 Glycine Thermo Fisher Scientific Cat# BP381-5 Agarose Thermo Fisher Scientific Cat# BP1356-500 Benzamidine Sigma-Aldrich Cat#B6506-5G Proteinase Inhibitor Cocktail Calbiochem Cat#539137-10VL Dynabeads Protein G Invitrogen Cat#10003D Tris base Thermo Fisher Scientific Cat# BP152-5 NP-40 Sigma-Aldrich Cat# 11332473001 NaDOC Sigma-Aldrich Cat# D6750-25G Ultrapure Water Fisher Scientific Cat# 10-977-015 Quick Ligation Kit New England Bioscience Cat# M2200S Quick Ligase New England Bioscience Cat#E7337A Nanosep MF Filter Tube VWR Cat#29300-642 Sybr Gold Invitrogen Cat#S11494 40% Polyacrylamide Biorad Cat# 161-0146 Ammonium Persulfate VWR Cat# EM-2300 TEMED VWR Cat# PAV3161 6x loading dye Thermo Fisher Scientific Cat# R0631 NaOAC Thermo Fisher Scientific Cat# S25531 Glycoblue Invitrogen Cat# AM9515 NEBNext High Fidelity 2X PCR Master Mix New England Bioscience Cat# M0541L MboI-HF enzyme New England Bioscience Cat#R0147 Biotin-14-dATP Life Technologies Cat#19523-016 DNA Polymerase (Klenow) New England Bioscience Cat#M0210 10x NEB buffer New England Bioscience Cat#B0202 T4 DNA Ligase New England Bioscience Cat#M0202 Dynabeads Streptavidin Life Technologies Cat#65602 (Continued on next page) Immunity 56, 959–978.e1–e10, May 9, 2023 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Klenow exo minus New England Bioscience Cat#M0212 NEBNext Ultra II Q5 Master Mix New England Bioscience Cat#M0544S Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#554714 Foxp3/Transcription Factor Staining Buffer Set eBiosciences Cat#00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#MIR 2300 LS Columns Miltenyi Biotec Cat#130-042 APC BrdU Kit BD Biosciences Cat#557892; RRID:AB_2861367 FlexiGene Kit Qiagen Cat#51206 Superscript II Thermo Fisher Scientific Cat#18-064-014 Zymo DNA Clean&Concentrator Zymo Research Cat#D4030 End-it DNA End-repair Kit Lucigen Cat#ER81050 NEB Library Index New England Biosciences Cat#E7600S Qubit dsDNA HS Assay Thermo Fisher Scientific Cat#Q32851 Deposited data CD8+ T cell histone modifications ChIP Yu et al.14 GSE89036 Patient RNA Seq Gregor et al.47; Konrad et al.48 GSE46833 Tbet ChIP-Seq Dominguez et al.41 PRJNA287664 Hi-C Sequencing This paper GSE205081 Naive and Memory Hi-C Sequencing Russ et al.32 GSE225885 CTCF knockdown RNA Sequencing This paper GSE205079 CTCF ChIP-Seq This paper GSE205077 Input ChIP-Seq Yu et al.14 GSE89036 CTCF Cut&Run This paper GSE205077 CTCF knockdown Cut&Run This paper GSE205077 CTCF knockdown ATAC This paper GSE205076 Experimental models: Cell lines B16-GP33-41 Dr. A. Lamarre, INRS-institut Armand-Frappier N/A PLAT-E Cell Biolabs Cat#RV-101; RRID: CCL_B488 Experimental models: Organisms/strains P14 (B6.Cg-Tcratm1Mom Tg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Cat#037394-JAX; RRID: MMRRC_037394-JAX OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID: IMRS_JAX:003831 CD45.2 (C57BL/6J) The Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Cat#002014; RRID: IMSR_JAX:002014 CD45.1.2 Bred in-house N/A Oligonucleotides CTCF- forward for qPCR: 5’- AGTGAAAATGCTGAGCCGGA-3’ IDT N/A CTCF-reverse for qPCR: 5’- ATGATGGCTGTTGGCTGGTT-3’ IDT N/A Hprt-forward for qPCR: 5’- GGCCAGACTTTGTTGGATTT-3’ IDT N/A Hprt-reverse for qPCR: 5’- CAACTTGCGCTCATCT-3’. .. IDT N/A Gapdh-forward for qPCR:5’AGGTCGGTGTGAACGGATTTG-3’ IDT N/A (Continued on next page) e4 Immunity 56, 959–978.e1–e10, May 9, 2023

    Real-time Polymerase Chain Reaction:

    Article Title: DNA architectural protein CTCF facilitates subset-specific chromatin interactions to limit the formation of memory CD8 + T cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER AMPure XP beads Beckman Coulter Cat#A63880 Brilliant II Sybr Green Agilent Technologies Cat#600828 Phenol-Chloroform Invitrogen Cat#15593049 DPBS Gibco Cat#14190250 Concanavalin A beads Bangs Laboratories Cat#BP531 CaCl2 Fisher Scientific Cat# BP510-500 RNase A Qiagen Cat#19101 Glycogen Millipore Sigma Cat#10901393001 SDS Fisher Scientific Cat#BP166-100 Proteinase K Fisher Scientific Cat#BP1700-50 Ethanol Sigma-Aldrich Cat#E7023-500ML Maxtract High-density tubes Qiagen Cat#129046 KCl Sigma-Aldrich Cat#P3911-25G Spermidine Sigma-Aldrich Cat#S2501-5G PEG 8000 Sigma-Aldrich Cat#202452-500G NaCl Thermo Fisher Scientific Cat# S271-500 EDTA Thermo Fisher Scientific Cat#17892 EGTA Sigma Aldrich Cat#E3889 Triton X-100 Sigma Aldrich Cat#X100-5ML cOmplete , EDTA-free Protease Inhibitor Cocktail Millipore Sigma Cat#5056489001 Formaldehyde Sigma-Aldrich Cat# FP8775 Glycine Thermo Fisher Scientific Cat# BP381-5 Agarose Thermo Fisher Scientific Cat# BP1356-500 Benzamidine Sigma-Aldrich Cat#B6506-5G Proteinase Inhibitor Cocktail Calbiochem Cat#539137-10VL Dynabeads Protein G Invitrogen Cat#10003D Tris base Thermo Fisher Scientific Cat# BP152-5 NP-40 Sigma-Aldrich Cat# 11332473001 NaDOC Sigma-Aldrich Cat# D6750-25G Ultrapure Water Fisher Scientific Cat# 10-977-015 Quick Ligation Kit New England Bioscience Cat# M2200S Quick Ligase New England Bioscience Cat#E7337A Nanosep MF Filter Tube VWR Cat#29300-642 Sybr Gold Invitrogen Cat#S11494 40% Polyacrylamide Biorad Cat# 161-0146 Ammonium Persulfate VWR Cat# EM-2300 TEMED VWR Cat# PAV3161 6x loading dye Thermo Fisher Scientific Cat# R0631 NaOAC Thermo Fisher Scientific Cat# S25531 Glycoblue Invitrogen Cat# AM9515 NEBNext High Fidelity 2X PCR Master Mix New England Bioscience Cat# M0541L MboI-HF enzyme New England Bioscience Cat#R0147 Biotin-14-dATP Life Technologies Cat#19523-016 DNA Polymerase (Klenow) New England Bioscience Cat#M0210 10x NEB buffer New England Bioscience Cat#B0202 T4 DNA Ligase New England Bioscience Cat#M0202 Dynabeads Streptavidin Life Technologies Cat#65602 (Continued on next page) Immunity 56, 959–978.e1–e10, May 9, 2023 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Klenow exo minus New England Bioscience Cat#M0212 NEBNext Ultra II Q5 Master Mix New England Bioscience Cat#M0544S Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#554714 Foxp3/Transcription Factor Staining Buffer Set eBiosciences Cat#00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#MIR 2300 LS Columns Miltenyi Biotec Cat#130-042 APC BrdU Kit BD Biosciences Cat#557892; RRID:AB_2861367 FlexiGene Kit Qiagen Cat#51206 Superscript II Thermo Fisher Scientific Cat#18-064-014 Zymo DNA Clean&Concentrator Zymo Research Cat#D4030 End-it DNA End-repair Kit Lucigen Cat#ER81050 NEB Library Index New England Biosciences Cat#E7600S Qubit dsDNA HS Assay Thermo Fisher Scientific Cat#Q32851 Deposited data CD8+ T cell histone modifications ChIP Yu et al.14 GSE89036 Patient RNA Seq Gregor et al.47; Konrad et al.48 GSE46833 Tbet ChIP-Seq Dominguez et al.41 PRJNA287664 Hi-C Sequencing This paper GSE205081 Naive and Memory Hi-C Sequencing Russ et al.32 GSE225885 CTCF knockdown RNA Sequencing This paper GSE205079 CTCF ChIP-Seq This paper GSE205077 Input ChIP-Seq Yu et al.14 GSE89036 CTCF Cut&Run This paper GSE205077 CTCF knockdown Cut&Run This paper GSE205077 CTCF knockdown ATAC This paper GSE205076 Experimental models: Cell lines B16-GP33-41 Dr. A. Lamarre, INRS-institut Armand-Frappier N/A PLAT-E Cell Biolabs Cat#RV-101; RRID: CCL_B488 Experimental models: Organisms/strains P14 (B6.Cg-Tcratm1Mom Tg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Cat#037394-JAX; RRID: MMRRC_037394-JAX OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID: IMRS_JAX:003831 CD45.2 (C57BL/6J) The Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Cat#002014; RRID: IMSR_JAX:002014 CD45.1.2 Bred in-house N/A Oligonucleotides CTCF- forward for qPCR: 5’- AGTGAAAATGCTGAGCCGGA-3’ IDT N/A CTCF-reverse for qPCR: 5’- ATGATGGCTGTTGGCTGGTT-3’ IDT N/A Hprt-forward for qPCR: 5’- GGCCAGACTTTGTTGGATTT-3’ IDT N/A Hprt-reverse for qPCR: 5’- CAACTTGCGCTCATCT-3’. .. IDT N/A Gapdh-forward for qPCR:5’AGGTCGGTGTGAACGGATTTG-3’ IDT N/A (Continued on next page) e4 Immunity 56, 959–978.e1–e10, May 9, 2023

    Recombinant:

    Article Title: Glutathione de novo synthesis but not recycling process coordinates with glutamine catabolism to control redox homeostasis and directs murine T cell differentiation
    Article Snippet: DOI: https://doi.org/10.7554/eLife.36158 16 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Genetic reagent (Mus musculus) CD4-Cre Gclcflox/flox PMID:23226398 Genetic reagent (Mus musculus) Gclm-KO PMID:12384496 Genetic reagent (Mus musculus) ROSA26CreERT2 RRID: IMSR_JAX:008463 The Jackson Laboratory Genetic reagent (Mus musculus) GSR-KO PMID: 10218442 Antibody Mouse antiCD3 mAb Cat. #:BE0001-1, RRID:AB_1107634 BioXcell Antibody Mouse antiCD28 mAb Cat. #BE0015-1 RRID:AB_1107624 BioXcell Antibody Mouse anti -IL2 mAb Cat.#BE0043 RRID::AB_1107702 BioXcell Antibody Mouse antiIL4 mAb Cat. #BE0045 RRID:AB_1107707 BioXcell Antibody Mouse antiIFNg mAb Cat. #BE0055 RRID:AB_1107694 BioXcell Antibody Anti mouse CD4-FITC Cat. #11–0042 RRID:AB_464897 eBioscience (1:200) Antibody Anti mouse CD4-APC Cat. #17-0041-81 RRID:AB_469319 eBioscience (1:200) Antibody Anti mouse CD8-APC-Cy7 Cat. #100714 RRID:AB_312753 Biolegend (1:200) Antibody Anti mouse Foxp3-APC Cat. # RRID:AB_469456 eBioscience (1:200) Antibody Anti mouse IL-17A-PECy7 Cat. #25-7177-82 RRID:AB_10732356 eBioscience (1:200) Antibody Anti GCLC antibody (rabbit monoclonal) Cat. #ab190685 RRID:AB_10975474 Abcam WB (1:1000) Antibody Anti GCLM antibody (rabbit monoclonal) Cat. #ab124827 RRID:AB_10975474 Abcam WB (1:1000) Antibody anti-mouse CD25 -PE Cat. #101904 RRID:AB_312847 Biolegend (1:200) Antibody anti-mouse CD69-PECy7 Cat. #552879 RRID:AB_394508 BD Bioscience (1:200) Antibody Anti mouse monoclonal CD3 Cat. #sc-101442 RRID:AB_1120355 Santa Cruz IHC (1:50) Antibody Anti mouse monoclonal galectin-3 Cat. #sc-32790, RRID:AB_627657 Santa Cruz IHC (1:50) Peptide, recombinant protein MOG35-55 peptide synthesized and HPLC-purified St. Jude Hartwell Center for Biotechnology Peptide, recombinant protein Recombinant mouse IL-6 216–16 Peprotech Peptide, recombinant protein Recombinant human TGFb 100–21 c Peprotech Continued on next page Lian et al. eLife 2018;7:e36158. .. DOI: https://doi.org/10.7554/eLife.36158 17 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Peptide, recombinant protein Recombinant human or mouse IL-2 200–02 Peprotech Commercial assay or kit Foxp3/Transcription Factor Staining Buffer Set 00-5523-00 e-Bioscience Commercial assay or kit Naive CD4 + T cell isolation kit,mouse 5160725186 Miltenyi Biotec Commercial assay or kit CD45R(B220) microbeads, mouse 5150309030 Miltenyi Biotec Commercial assay or kit ABC kit PK-7200 Vector laboratories Commercial assay or kit MojoSort Mouse naive CD4 T Cell Isolation Kit 480031 Biolegend Chemical compound, drug Diethly Fumerate Sigma Aldrich D95654 Chemical compound, drug N-Acetyl-L-cysteine Sigma-Aldrich A7250 Chemical compound, drug Tamofixen Sigma-Aldrich T5648 Chemical compound, drug 4-hydroxytamoxifen Sigma H7904 Chemical compound, drug Dimethy a-keto glutarate/aKG Sigma-Aldrich 34963–1 Chemical compound, drug Hypoxathine Sigma-Aldrich H9377 Chemical compound, drug Thymidine Sigma T9250 Chemical compound, drug H2O2 Sigma-Aldrich 7722-84-1 Chemical compound, drug carboxyfluorescein diacetate succinimidyl ester(CFSE) Invitrogen C1157 Chemical compound, drug DM-H2DCFDA Invitrogen C6827 Chemical compound, drug DAB Vector Laboratories SK-4100 Chemical compound, drug Monobromobimane Invitrogen M1378 Chemical compound, drug 7-aminoactinomycin D(7AAD) Biolegend 420404 Chemical compound, drug Pertussis toxin 181 List Biological Laboratories Chemical compound, drug Mycobacterium tuberculosum 231141 Difco Chemical compound, drug Incomplete Freund’s Adjuvant 263910 Difco Chemical compound, drug [U-14C]-glutamine MC 1124 Moravek Chemical compound, drug [2–14C]-pyruvate ARC 0222 American Radiolabeled Chemicals Continued on next page Lian et al. eLife 2018;7:e36158. .. DOI: https://doi.org/10.7554/eLife.36158 18 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Cell Stimulation Cocktail (plus protein transport inhibitors) (500X) 00-4975-93 eBioscience Chemical compound, drug Iscove’s Modified Dulbecco’s Media - Glucose free conditional medium ME17058P1 Thermo Fisher Scientific Chemical compound, drug Iscove’s Modified Dulbecco’s Media - without L-glutamine 12–726 f Lonza Chemical compound, drug RPMI 1640 Medium, No Glucose 11-879-020 Gibco Chemical compound, drug Hyclone RPMI 1640 Medium, no glutamine sh30096.10 Thermo Fisher Scientific Chemical compound, drug U-13C6-glutamine CNLM-1275–0.1 Cambridge Isotope Lab Chemical compound, drug 6-Diazo-5-oxo-L -norleucine D2141-5MG Sigma-aldrich Chemical compound, drug Bis-2(5-phenylacetamido -1,3,4-thiadiazol-2-yl) ethyl sulfide (BPTES) SML0601 Sigma-aldrich Chemical compound, drug CB-839 22038 Cayman Software, algorithm Graphpad Prism RRID:SCR_002798 Software, algorithm FlowJo RRID:SCR_008520

    Cell Isolation:

    Article Title: Glutathione de novo synthesis but not recycling process coordinates with glutamine catabolism to control redox homeostasis and directs murine T cell differentiation
    Article Snippet: DOI: https://doi.org/10.7554/eLife.36158 16 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Genetic reagent (Mus musculus) CD4-Cre Gclcflox/flox PMID:23226398 Genetic reagent (Mus musculus) Gclm-KO PMID:12384496 Genetic reagent (Mus musculus) ROSA26CreERT2 RRID: IMSR_JAX:008463 The Jackson Laboratory Genetic reagent (Mus musculus) GSR-KO PMID: 10218442 Antibody Mouse antiCD3 mAb Cat. #:BE0001-1, RRID:AB_1107634 BioXcell Antibody Mouse antiCD28 mAb Cat. #BE0015-1 RRID:AB_1107624 BioXcell Antibody Mouse anti -IL2 mAb Cat.#BE0043 RRID::AB_1107702 BioXcell Antibody Mouse antiIL4 mAb Cat. #BE0045 RRID:AB_1107707 BioXcell Antibody Mouse antiIFNg mAb Cat. #BE0055 RRID:AB_1107694 BioXcell Antibody Anti mouse CD4-FITC Cat. #11–0042 RRID:AB_464897 eBioscience (1:200) Antibody Anti mouse CD4-APC Cat. #17-0041-81 RRID:AB_469319 eBioscience (1:200) Antibody Anti mouse CD8-APC-Cy7 Cat. #100714 RRID:AB_312753 Biolegend (1:200) Antibody Anti mouse Foxp3-APC Cat. # RRID:AB_469456 eBioscience (1:200) Antibody Anti mouse IL-17A-PECy7 Cat. #25-7177-82 RRID:AB_10732356 eBioscience (1:200) Antibody Anti GCLC antibody (rabbit monoclonal) Cat. #ab190685 RRID:AB_10975474 Abcam WB (1:1000) Antibody Anti GCLM antibody (rabbit monoclonal) Cat. #ab124827 RRID:AB_10975474 Abcam WB (1:1000) Antibody anti-mouse CD25 -PE Cat. #101904 RRID:AB_312847 Biolegend (1:200) Antibody anti-mouse CD69-PECy7 Cat. #552879 RRID:AB_394508 BD Bioscience (1:200) Antibody Anti mouse monoclonal CD3 Cat. #sc-101442 RRID:AB_1120355 Santa Cruz IHC (1:50) Antibody Anti mouse monoclonal galectin-3 Cat. #sc-32790, RRID:AB_627657 Santa Cruz IHC (1:50) Peptide, recombinant protein MOG35-55 peptide synthesized and HPLC-purified St. Jude Hartwell Center for Biotechnology Peptide, recombinant protein Recombinant mouse IL-6 216–16 Peprotech Peptide, recombinant protein Recombinant human TGFb 100–21 c Peprotech Continued on next page Lian et al. eLife 2018;7:e36158. .. DOI: https://doi.org/10.7554/eLife.36158 17 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Peptide, recombinant protein Recombinant human or mouse IL-2 200–02 Peprotech Commercial assay or kit Foxp3/Transcription Factor Staining Buffer Set 00-5523-00 e-Bioscience Commercial assay or kit Naive CD4 + T cell isolation kit,mouse 5160725186 Miltenyi Biotec Commercial assay or kit CD45R(B220) microbeads, mouse 5150309030 Miltenyi Biotec Commercial assay or kit ABC kit PK-7200 Vector laboratories Commercial assay or kit MojoSort Mouse naive CD4 T Cell Isolation Kit 480031 Biolegend Chemical compound, drug Diethly Fumerate Sigma Aldrich D95654 Chemical compound, drug N-Acetyl-L-cysteine Sigma-Aldrich A7250 Chemical compound, drug Tamofixen Sigma-Aldrich T5648 Chemical compound, drug 4-hydroxytamoxifen Sigma H7904 Chemical compound, drug Dimethy a-keto glutarate/aKG Sigma-Aldrich 34963–1 Chemical compound, drug Hypoxathine Sigma-Aldrich H9377 Chemical compound, drug Thymidine Sigma T9250 Chemical compound, drug H2O2 Sigma-Aldrich 7722-84-1 Chemical compound, drug carboxyfluorescein diacetate succinimidyl ester(CFSE) Invitrogen C1157 Chemical compound, drug DM-H2DCFDA Invitrogen C6827 Chemical compound, drug DAB Vector Laboratories SK-4100 Chemical compound, drug Monobromobimane Invitrogen M1378 Chemical compound, drug 7-aminoactinomycin D(7AAD) Biolegend 420404 Chemical compound, drug Pertussis toxin 181 List Biological Laboratories Chemical compound, drug Mycobacterium tuberculosum 231141 Difco Chemical compound, drug Incomplete Freund’s Adjuvant 263910 Difco Chemical compound, drug [U-14C]-glutamine MC 1124 Moravek Chemical compound, drug [2–14C]-pyruvate ARC 0222 American Radiolabeled Chemicals Continued on next page Lian et al. eLife 2018;7:e36158. .. DOI: https://doi.org/10.7554/eLife.36158 18 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Cell Stimulation Cocktail (plus protein transport inhibitors) (500X) 00-4975-93 eBioscience Chemical compound, drug Iscove’s Modified Dulbecco’s Media - Glucose free conditional medium ME17058P1 Thermo Fisher Scientific Chemical compound, drug Iscove’s Modified Dulbecco’s Media - without L-glutamine 12–726 f Lonza Chemical compound, drug RPMI 1640 Medium, No Glucose 11-879-020 Gibco Chemical compound, drug Hyclone RPMI 1640 Medium, no glutamine sh30096.10 Thermo Fisher Scientific Chemical compound, drug U-13C6-glutamine CNLM-1275–0.1 Cambridge Isotope Lab Chemical compound, drug 6-Diazo-5-oxo-L -norleucine D2141-5MG Sigma-aldrich Chemical compound, drug Bis-2(5-phenylacetamido -1,3,4-thiadiazol-2-yl) ethyl sulfide (BPTES) SML0601 Sigma-aldrich Chemical compound, drug CB-839 22038 Cayman Software, algorithm Graphpad Prism RRID:SCR_002798 Software, algorithm FlowJo RRID:SCR_008520

    Adjuvant:

    Article Title: Glutathione de novo synthesis but not recycling process coordinates with glutamine catabolism to control redox homeostasis and directs murine T cell differentiation
    Article Snippet: DOI: https://doi.org/10.7554/eLife.36158 16 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Genetic reagent (Mus musculus) CD4-Cre Gclcflox/flox PMID:23226398 Genetic reagent (Mus musculus) Gclm-KO PMID:12384496 Genetic reagent (Mus musculus) ROSA26CreERT2 RRID: IMSR_JAX:008463 The Jackson Laboratory Genetic reagent (Mus musculus) GSR-KO PMID: 10218442 Antibody Mouse antiCD3 mAb Cat. #:BE0001-1, RRID:AB_1107634 BioXcell Antibody Mouse antiCD28 mAb Cat. #BE0015-1 RRID:AB_1107624 BioXcell Antibody Mouse anti -IL2 mAb Cat.#BE0043 RRID::AB_1107702 BioXcell Antibody Mouse antiIL4 mAb Cat. #BE0045 RRID:AB_1107707 BioXcell Antibody Mouse antiIFNg mAb Cat. #BE0055 RRID:AB_1107694 BioXcell Antibody Anti mouse CD4-FITC Cat. #11–0042 RRID:AB_464897 eBioscience (1:200) Antibody Anti mouse CD4-APC Cat. #17-0041-81 RRID:AB_469319 eBioscience (1:200) Antibody Anti mouse CD8-APC-Cy7 Cat. #100714 RRID:AB_312753 Biolegend (1:200) Antibody Anti mouse Foxp3-APC Cat. # RRID:AB_469456 eBioscience (1:200) Antibody Anti mouse IL-17A-PECy7 Cat. #25-7177-82 RRID:AB_10732356 eBioscience (1:200) Antibody Anti GCLC antibody (rabbit monoclonal) Cat. #ab190685 RRID:AB_10975474 Abcam WB (1:1000) Antibody Anti GCLM antibody (rabbit monoclonal) Cat. #ab124827 RRID:AB_10975474 Abcam WB (1:1000) Antibody anti-mouse CD25 -PE Cat. #101904 RRID:AB_312847 Biolegend (1:200) Antibody anti-mouse CD69-PECy7 Cat. #552879 RRID:AB_394508 BD Bioscience (1:200) Antibody Anti mouse monoclonal CD3 Cat. #sc-101442 RRID:AB_1120355 Santa Cruz IHC (1:50) Antibody Anti mouse monoclonal galectin-3 Cat. #sc-32790, RRID:AB_627657 Santa Cruz IHC (1:50) Peptide, recombinant protein MOG35-55 peptide synthesized and HPLC-purified St. Jude Hartwell Center for Biotechnology Peptide, recombinant protein Recombinant mouse IL-6 216–16 Peprotech Peptide, recombinant protein Recombinant human TGFb 100–21 c Peprotech Continued on next page Lian et al. eLife 2018;7:e36158. .. DOI: https://doi.org/10.7554/eLife.36158 17 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Peptide, recombinant protein Recombinant human or mouse IL-2 200–02 Peprotech Commercial assay or kit Foxp3/Transcription Factor Staining Buffer Set 00-5523-00 e-Bioscience Commercial assay or kit Naive CD4 + T cell isolation kit,mouse 5160725186 Miltenyi Biotec Commercial assay or kit CD45R(B220) microbeads, mouse 5150309030 Miltenyi Biotec Commercial assay or kit ABC kit PK-7200 Vector laboratories Commercial assay or kit MojoSort Mouse naive CD4 T Cell Isolation Kit 480031 Biolegend Chemical compound, drug Diethly Fumerate Sigma Aldrich D95654 Chemical compound, drug N-Acetyl-L-cysteine Sigma-Aldrich A7250 Chemical compound, drug Tamofixen Sigma-Aldrich T5648 Chemical compound, drug 4-hydroxytamoxifen Sigma H7904 Chemical compound, drug Dimethy a-keto glutarate/aKG Sigma-Aldrich 34963–1 Chemical compound, drug Hypoxathine Sigma-Aldrich H9377 Chemical compound, drug Thymidine Sigma T9250 Chemical compound, drug H2O2 Sigma-Aldrich 7722-84-1 Chemical compound, drug carboxyfluorescein diacetate succinimidyl ester(CFSE) Invitrogen C1157 Chemical compound, drug DM-H2DCFDA Invitrogen C6827 Chemical compound, drug DAB Vector Laboratories SK-4100 Chemical compound, drug Monobromobimane Invitrogen M1378 Chemical compound, drug 7-aminoactinomycin D(7AAD) Biolegend 420404 Chemical compound, drug Pertussis toxin 181 List Biological Laboratories Chemical compound, drug Mycobacterium tuberculosum 231141 Difco Chemical compound, drug Incomplete Freund’s Adjuvant 263910 Difco Chemical compound, drug [U-14C]-glutamine MC 1124 Moravek Chemical compound, drug [2–14C]-pyruvate ARC 0222 American Radiolabeled Chemicals Continued on next page Lian et al. eLife 2018;7:e36158. .. DOI: https://doi.org/10.7554/eLife.36158 18 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Cell Stimulation Cocktail (plus protein transport inhibitors) (500X) 00-4975-93 eBioscience Chemical compound, drug Iscove’s Modified Dulbecco’s Media - Glucose free conditional medium ME17058P1 Thermo Fisher Scientific Chemical compound, drug Iscove’s Modified Dulbecco’s Media - without L-glutamine 12–726 f Lonza Chemical compound, drug RPMI 1640 Medium, No Glucose 11-879-020 Gibco Chemical compound, drug Hyclone RPMI 1640 Medium, no glutamine sh30096.10 Thermo Fisher Scientific Chemical compound, drug U-13C6-glutamine CNLM-1275–0.1 Cambridge Isotope Lab Chemical compound, drug 6-Diazo-5-oxo-L -norleucine D2141-5MG Sigma-aldrich Chemical compound, drug Bis-2(5-phenylacetamido -1,3,4-thiadiazol-2-yl) ethyl sulfide (BPTES) SML0601 Sigma-aldrich Chemical compound, drug CB-839 22038 Cayman Software, algorithm Graphpad Prism RRID:SCR_002798 Software, algorithm FlowJo RRID:SCR_008520

    Red Blood Cell Lysis:

    Article Title: Innate lymphoid cells integrate sensing and plasticity to control fungal infections
    Article Snippet: Cat# 65-0840-90 Cyanine5 Streptavidin Biolegend Cat#405209 APC-Fire750 Streptavidin Biolegend Cat#405250 Streptavidin-DyLight 488 (currently marketed as Alexa Fluor 488) Jackson ImmunoResearch Cat#016-540-084 7-AAD Viability Staining Solution Biolegend Cat#420403 Apotracker Green Biolegend Cat#427401 Zombie Aqua Fixable Viability Kit Biolegend Cat#423102 Zombie NIR Fixable Viability Kit Biolegend Cat#423105 Zombie Violet Fixable Viability Kit Biolegend Cat#423113 Collagenase II Gibco; Fisher Scientific Cat# 17101015 DNAse I Sigma-Aldrich Cat#10104159001 Percoll GE-Healthcare Cat#GE17-0891-01 Recombinant Mouse IL-2 Biolegend Cat#575404 Recombinant Mouse IL-7 Biolegend Cat#577802 Recombinant Mouse SCF Miltenyi Cat#130-101-693 Recombinant Mouse IL-1β MedchemExpress Cat# MCE-HY-P7073A-2μg Recombinant Mouse IL-23 Biolegend Cat#589002 Recombinant Mouse IL-17C BioTechne Cat#2306-ML-025 Recombinant Rat/Mouse TGFβ1 MedchemExpress MCE-HY-P7117-2μg Brefeldin A Biolegend Cat#420601 Phorbol myristate acetate (PMA) Sigma-Aldrich Cat#P1585 Ionomycin Sigma-Aldrich Cat#IO634 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D2438 Zymosan Sigma-Aldrich Cat#Z4250 Curdlan Invivogen Cat#tlrl-cura Laminarin Invivogen Cat#tlrl-lam Chitin Wagener et al.115 N/A Dynasore hydrate Sigma-Aldrich Cat#D7693 R406 (Syk Inhibitor) Selleckchem Cat#S2194 α-D-Mannan Sigma-Aldrich Cat#M7504 Ketamin: Ketasol Livisto GTIN# 04050478000336 Xylazine: Sedaxylan Dechra GTIN# 08714225157464 Intracellular Staining Permeabilization Wash Buffer (10X) Biolegend Cat#421002 Fixation Buffer Biolegend Cat#420801 (Continued on next page) 22 Cell Reports 45, 117140, April 28, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Red Blood Cell Lysis Buffer (10X) Biolegend Cat#420302 True-Phos Perm Buffer Biolegend Cat#425401 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich Cat#8537 Hanks’ Balanced Salt solution Sigma-Aldrich Cat#8264 IMDM (Iscove’s Modified Dulbecco’s Medium) Lonza Cat#12-722F RPMI 1640 Medium Gibco; Fisher Scientific Cat#21875091 GlutaMAX Supplement Gibco; Fisher Scientific Cat#35050061 HEPES (1M) Gibco; Fisher Scientific Cat#15630080 Sodium pyruvate solution,100 mM Sigma-Aldrich Cat#S8636 MEM Non-essential Amino Acid Solution (100X) Sigma-Aldrich Cat#M7145 RNAlater Sigma-Aldrich Cat#R0901 z-IETD-FMK MedchemExpress Cat#MCE-HY-101297-1mg Necrostatin-1 MedchemExpress Cat#HY-15760 Ultra PureTM Distilled DNAse/RNAse free Water Invitrogen; Fisher Scientific Cat#10977049 Commercial assays Lineage cell depletion kit, mouse Miltenyi Cat#130-090-858 Foxp3/Transcription Factor Staining Buffer Set-1 kit eBioscience, Fisher Scient. .. Cat#00-5523-00 System for Reverse Transcription Using AMV RT Promega Cat#A3500 SsoAdvanced Universal SYBR Green Supermix Biorad Cat#1725271 QIAGEN RNeasy Plus Micro Kit Quiagen Cat#74034 Monarch Spin RNA Cleanup Kit (10 μg) New England Biolabs Cat#T2030L Deposited data Mass Spectrometry of culture supernatants (ILC-Cgl interaction) ProteomeXchange Consortium111 PRIDE:PXD061271 Pulmonary ILC Sequencing (Smart-Seq2) GEO-database GEO:GSE293220 RNA-Sequencing of infected lung tissues after ILC-transfer GEO-database GEO:GSE293054 Experimental models cell lines Feeder cells: OP9-DL1 Gift of Meinrad Busslinger Schmitt & Zúñiga-Pflücker116 Experimental murine models, strains Mouse: C57BL/6J mice Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 Mouse: Rag1− /− : B6.129S7-Rag1tm1Mom/J Jackson Laboratory RRID:IMSR_JAX:002096 Mouse: Rag2− /− Il2rg− /− Cao et al.117 Veronika Sexl Mouse: IL17A-IRES-GFP-KI reporter: C57BL/6-Il17atm1Bcgen/J Jackson Laboratory RRID: IMSR_JAX:018472 Mouse: Tec− /− Rag1− /− IL-17AeGFP: C57BL/6Il17atm1Bcgen/J x Tectm1Welm x B6.129S7-Rag1tm1Mom/J This study N/A Mouse: Dectin-1− /− : B6.129S6-Clec7atm1Gdb/J Taylor et al.118 RRID:IMSR_JAX:012337 Mouse: Dectin-2− /− : Clec4ntm1Yiw Saijo et al.119 MGI:4459637 Mouse: Tlr2/− : Tlr2tm1Aki Takeuchi et al.120 MGI:2178675 Mouse: Tlr4− /− : Tlr4tm1Aki Hashino et al.121 MGI:1860885 Mouse: Tec− /− : Tectm1Welm Ellmeier et al.34 MGI:2450883 Oligonucleotides m-Eef1a forward/reverse (5′-3′): ACGAGGCAATGTTG CTGGTGAC/GTGTGACAATCCAGAACAGGAGC Origene Cat#MP204369; GenBank:NM_010106 m-Tgfb1 forward/reverse (5′-3′): TGACGTCACTGGA GTTGTACGG/GGTTCATGTCATGGATGGTGC N/A GenBank:NM_011577.2 m-Il1b forward/reverse (5′-3′): (CCAACAAGTGATAT TCTCCATGAG/TCTTTCATTACACAGGACAGGT) N/A GenBank:NM_008361.4 (Continued on next page) Cell Reports 45, 117140, April 28, 2026 23

    Saline:

    Article Title: Innate lymphoid cells integrate sensing and plasticity to control fungal infections
    Article Snippet: Cat# 65-0840-90 Cyanine5 Streptavidin Biolegend Cat#405209 APC-Fire750 Streptavidin Biolegend Cat#405250 Streptavidin-DyLight 488 (currently marketed as Alexa Fluor 488) Jackson ImmunoResearch Cat#016-540-084 7-AAD Viability Staining Solution Biolegend Cat#420403 Apotracker Green Biolegend Cat#427401 Zombie Aqua Fixable Viability Kit Biolegend Cat#423102 Zombie NIR Fixable Viability Kit Biolegend Cat#423105 Zombie Violet Fixable Viability Kit Biolegend Cat#423113 Collagenase II Gibco; Fisher Scientific Cat# 17101015 DNAse I Sigma-Aldrich Cat#10104159001 Percoll GE-Healthcare Cat#GE17-0891-01 Recombinant Mouse IL-2 Biolegend Cat#575404 Recombinant Mouse IL-7 Biolegend Cat#577802 Recombinant Mouse SCF Miltenyi Cat#130-101-693 Recombinant Mouse IL-1β MedchemExpress Cat# MCE-HY-P7073A-2μg Recombinant Mouse IL-23 Biolegend Cat#589002 Recombinant Mouse IL-17C BioTechne Cat#2306-ML-025 Recombinant Rat/Mouse TGFβ1 MedchemExpress MCE-HY-P7117-2μg Brefeldin A Biolegend Cat#420601 Phorbol myristate acetate (PMA) Sigma-Aldrich Cat#P1585 Ionomycin Sigma-Aldrich Cat#IO634 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D2438 Zymosan Sigma-Aldrich Cat#Z4250 Curdlan Invivogen Cat#tlrl-cura Laminarin Invivogen Cat#tlrl-lam Chitin Wagener et al.115 N/A Dynasore hydrate Sigma-Aldrich Cat#D7693 R406 (Syk Inhibitor) Selleckchem Cat#S2194 α-D-Mannan Sigma-Aldrich Cat#M7504 Ketamin: Ketasol Livisto GTIN# 04050478000336 Xylazine: Sedaxylan Dechra GTIN# 08714225157464 Intracellular Staining Permeabilization Wash Buffer (10X) Biolegend Cat#421002 Fixation Buffer Biolegend Cat#420801 (Continued on next page) 22 Cell Reports 45, 117140, April 28, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Red Blood Cell Lysis Buffer (10X) Biolegend Cat#420302 True-Phos Perm Buffer Biolegend Cat#425401 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich Cat#8537 Hanks’ Balanced Salt solution Sigma-Aldrich Cat#8264 IMDM (Iscove’s Modified Dulbecco’s Medium) Lonza Cat#12-722F RPMI 1640 Medium Gibco; Fisher Scientific Cat#21875091 GlutaMAX Supplement Gibco; Fisher Scientific Cat#35050061 HEPES (1M) Gibco; Fisher Scientific Cat#15630080 Sodium pyruvate solution,100 mM Sigma-Aldrich Cat#S8636 MEM Non-essential Amino Acid Solution (100X) Sigma-Aldrich Cat#M7145 RNAlater Sigma-Aldrich Cat#R0901 z-IETD-FMK MedchemExpress Cat#MCE-HY-101297-1mg Necrostatin-1 MedchemExpress Cat#HY-15760 Ultra PureTM Distilled DNAse/RNAse free Water Invitrogen; Fisher Scientific Cat#10977049 Commercial assays Lineage cell depletion kit, mouse Miltenyi Cat#130-090-858 Foxp3/Transcription Factor Staining Buffer Set-1 kit eBioscience, Fisher Scient. .. Cat#00-5523-00 System for Reverse Transcription Using AMV RT Promega Cat#A3500 SsoAdvanced Universal SYBR Green Supermix Biorad Cat#1725271 QIAGEN RNeasy Plus Micro Kit Quiagen Cat#74034 Monarch Spin RNA Cleanup Kit (10 μg) New England Biolabs Cat#T2030L Deposited data Mass Spectrometry of culture supernatants (ILC-Cgl interaction) ProteomeXchange Consortium111 PRIDE:PXD061271 Pulmonary ILC Sequencing (Smart-Seq2) GEO-database GEO:GSE293220 RNA-Sequencing of infected lung tissues after ILC-transfer GEO-database GEO:GSE293054 Experimental models cell lines Feeder cells: OP9-DL1 Gift of Meinrad Busslinger Schmitt & Zúñiga-Pflücker116 Experimental murine models, strains Mouse: C57BL/6J mice Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 Mouse: Rag1− /− : B6.129S7-Rag1tm1Mom/J Jackson Laboratory RRID:IMSR_JAX:002096 Mouse: Rag2− /− Il2rg− /− Cao et al.117 Veronika Sexl Mouse: IL17A-IRES-GFP-KI reporter: C57BL/6-Il17atm1Bcgen/J Jackson Laboratory RRID: IMSR_JAX:018472 Mouse: Tec− /− Rag1− /− IL-17AeGFP: C57BL/6Il17atm1Bcgen/J x Tectm1Welm x B6.129S7-Rag1tm1Mom/J This study N/A Mouse: Dectin-1− /− : B6.129S6-Clec7atm1Gdb/J Taylor et al.118 RRID:IMSR_JAX:012337 Mouse: Dectin-2− /− : Clec4ntm1Yiw Saijo et al.119 MGI:4459637 Mouse: Tlr2/− : Tlr2tm1Aki Takeuchi et al.120 MGI:2178675 Mouse: Tlr4− /− : Tlr4tm1Aki Hashino et al.121 MGI:1860885 Mouse: Tec− /− : Tectm1Welm Ellmeier et al.34 MGI:2450883 Oligonucleotides m-Eef1a forward/reverse (5′-3′): ACGAGGCAATGTTG CTGGTGAC/GTGTGACAATCCAGAACAGGAGC Origene Cat#MP204369; GenBank:NM_010106 m-Tgfb1 forward/reverse (5′-3′): TGACGTCACTGGA GTTGTACGG/GGTTCATGTCATGGATGGTGC N/A GenBank:NM_011577.2 m-Il1b forward/reverse (5′-3′): (CCAACAAGTGATAT TCTCCATGAG/TCTTTCATTACACAGGACAGGT) N/A GenBank:NM_008361.4 (Continued on next page) Cell Reports 45, 117140, April 28, 2026 23

    Modification:

    Article Title: Innate lymphoid cells integrate sensing and plasticity to control fungal infections
    Article Snippet: Cat# 65-0840-90 Cyanine5 Streptavidin Biolegend Cat#405209 APC-Fire750 Streptavidin Biolegend Cat#405250 Streptavidin-DyLight 488 (currently marketed as Alexa Fluor 488) Jackson ImmunoResearch Cat#016-540-084 7-AAD Viability Staining Solution Biolegend Cat#420403 Apotracker Green Biolegend Cat#427401 Zombie Aqua Fixable Viability Kit Biolegend Cat#423102 Zombie NIR Fixable Viability Kit Biolegend Cat#423105 Zombie Violet Fixable Viability Kit Biolegend Cat#423113 Collagenase II Gibco; Fisher Scientific Cat# 17101015 DNAse I Sigma-Aldrich Cat#10104159001 Percoll GE-Healthcare Cat#GE17-0891-01 Recombinant Mouse IL-2 Biolegend Cat#575404 Recombinant Mouse IL-7 Biolegend Cat#577802 Recombinant Mouse SCF Miltenyi Cat#130-101-693 Recombinant Mouse IL-1β MedchemExpress Cat# MCE-HY-P7073A-2μg Recombinant Mouse IL-23 Biolegend Cat#589002 Recombinant Mouse IL-17C BioTechne Cat#2306-ML-025 Recombinant Rat/Mouse TGFβ1 MedchemExpress MCE-HY-P7117-2μg Brefeldin A Biolegend Cat#420601 Phorbol myristate acetate (PMA) Sigma-Aldrich Cat#P1585 Ionomycin Sigma-Aldrich Cat#IO634 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D2438 Zymosan Sigma-Aldrich Cat#Z4250 Curdlan Invivogen Cat#tlrl-cura Laminarin Invivogen Cat#tlrl-lam Chitin Wagener et al.115 N/A Dynasore hydrate Sigma-Aldrich Cat#D7693 R406 (Syk Inhibitor) Selleckchem Cat#S2194 α-D-Mannan Sigma-Aldrich Cat#M7504 Ketamin: Ketasol Livisto GTIN# 04050478000336 Xylazine: Sedaxylan Dechra GTIN# 08714225157464 Intracellular Staining Permeabilization Wash Buffer (10X) Biolegend Cat#421002 Fixation Buffer Biolegend Cat#420801 (Continued on next page) 22 Cell Reports 45, 117140, April 28, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Red Blood Cell Lysis Buffer (10X) Biolegend Cat#420302 True-Phos Perm Buffer Biolegend Cat#425401 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich Cat#8537 Hanks’ Balanced Salt solution Sigma-Aldrich Cat#8264 IMDM (Iscove’s Modified Dulbecco’s Medium) Lonza Cat#12-722F RPMI 1640 Medium Gibco; Fisher Scientific Cat#21875091 GlutaMAX Supplement Gibco; Fisher Scientific Cat#35050061 HEPES (1M) Gibco; Fisher Scientific Cat#15630080 Sodium pyruvate solution,100 mM Sigma-Aldrich Cat#S8636 MEM Non-essential Amino Acid Solution (100X) Sigma-Aldrich Cat#M7145 RNAlater Sigma-Aldrich Cat#R0901 z-IETD-FMK MedchemExpress Cat#MCE-HY-101297-1mg Necrostatin-1 MedchemExpress Cat#HY-15760 Ultra PureTM Distilled DNAse/RNAse free Water Invitrogen; Fisher Scientific Cat#10977049 Commercial assays Lineage cell depletion kit, mouse Miltenyi Cat#130-090-858 Foxp3/Transcription Factor Staining Buffer Set-1 kit eBioscience, Fisher Scient. .. Cat#00-5523-00 System for Reverse Transcription Using AMV RT Promega Cat#A3500 SsoAdvanced Universal SYBR Green Supermix Biorad Cat#1725271 QIAGEN RNeasy Plus Micro Kit Quiagen Cat#74034 Monarch Spin RNA Cleanup Kit (10 μg) New England Biolabs Cat#T2030L Deposited data Mass Spectrometry of culture supernatants (ILC-Cgl interaction) ProteomeXchange Consortium111 PRIDE:PXD061271 Pulmonary ILC Sequencing (Smart-Seq2) GEO-database GEO:GSE293220 RNA-Sequencing of infected lung tissues after ILC-transfer GEO-database GEO:GSE293054 Experimental models cell lines Feeder cells: OP9-DL1 Gift of Meinrad Busslinger Schmitt & Zúñiga-Pflücker116 Experimental murine models, strains Mouse: C57BL/6J mice Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 Mouse: Rag1− /− : B6.129S7-Rag1tm1Mom/J Jackson Laboratory RRID:IMSR_JAX:002096 Mouse: Rag2− /− Il2rg− /− Cao et al.117 Veronika Sexl Mouse: IL17A-IRES-GFP-KI reporter: C57BL/6-Il17atm1Bcgen/J Jackson Laboratory RRID: IMSR_JAX:018472 Mouse: Tec− /− Rag1− /− IL-17AeGFP: C57BL/6Il17atm1Bcgen/J x Tectm1Welm x B6.129S7-Rag1tm1Mom/J This study N/A Mouse: Dectin-1− /− : B6.129S6-Clec7atm1Gdb/J Taylor et al.118 RRID:IMSR_JAX:012337 Mouse: Dectin-2− /− : Clec4ntm1Yiw Saijo et al.119 MGI:4459637 Mouse: Tlr2/− : Tlr2tm1Aki Takeuchi et al.120 MGI:2178675 Mouse: Tlr4− /− : Tlr4tm1Aki Hashino et al.121 MGI:1860885 Mouse: Tec− /− : Tectm1Welm Ellmeier et al.34 MGI:2450883 Oligonucleotides m-Eef1a forward/reverse (5′-3′): ACGAGGCAATGTTG CTGGTGAC/GTGTGACAATCCAGAACAGGAGC Origene Cat#MP204369; GenBank:NM_010106 m-Tgfb1 forward/reverse (5′-3′): TGACGTCACTGGA GTTGTACGG/GGTTCATGTCATGGATGGTGC N/A GenBank:NM_011577.2 m-Il1b forward/reverse (5′-3′): (CCAACAAGTGATAT TCTCCATGAG/TCTTTCATTACACAGGACAGGT) N/A GenBank:NM_008361.4 (Continued on next page) Cell Reports 45, 117140, April 28, 2026 23



    Similar Products

    foxp3 transcription factor staining buffer  (Miltenyi Biotec)
    97
    Miltenyi Biotec foxp3 transcription factor staining buffer
    Foxp3 Transcription Factor Staining Buffer, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer/FoxP3+Staining+Buffer+Set/10__1016_slash_j__celrep__2026__117140-315-98-96
    Average 97 stars, based on 1 article reviews
    foxp3 transcription factor staining buffer - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    foxp3 transcription factor staining buffer  (Fisher Scientific)
    86
    Fisher Scientific foxp3 transcription factor staining buffer
    Foxp3 Transcription Factor Staining Buffer, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer/buffer+factor+foxp3+set+staining+transcription/bio_rxiv__64898__2026__03__23__713589-307-13-17
    Average 86 stars, based on 1 article reviews
    foxp3 transcription factor staining buffer - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    antibodies against intracellular cytokines  (Cytek Biosciences)
    97
    Cytek Biosciences antibodies against intracellular cytokines
    Antibodies Against Intracellular Cytokines, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer/Foxp3+%2F+Transcription+Factor+Staining+Buffer+Kit/pm41850240-336-24-18
    Average 97 stars, based on 1 article reviews
    antibodies against intracellular cytokines - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    foxp3 transcription factor staining buffer kit tonbo cat  (Cytek Biosciences)
    97
    Cytek Biosciences foxp3 transcription factor staining buffer kit tonbo cat
    Foxp3 Transcription Factor Staining Buffer Kit Tonbo Cat, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer/Foxp3+%2F+Transcription+Factor+Staining+Buffer+Kit/pm41856110-301-14-21
    Average 97 stars, based on 1 article reviews
    foxp3 transcription factor staining buffer kit tonbo cat - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    foxp3 transcription factor staining buffer kit  (Cytek Biosciences)
    97
    Cytek Biosciences foxp3 transcription factor staining buffer kit
    Foxp3 Transcription Factor Staining Buffer Kit, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer/Foxp3+%2F+Transcription+Factor+Staining+Buffer+Kit/pm41850240-336-13-18
    Average 97 stars, based on 1 article reviews
    foxp3 transcription factor staining buffer kit - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    surface antigen stained pbmcs  (Cytek Biosciences)
    97
    Cytek Biosciences surface antigen stained pbmcs
    Surface Antigen Stained Pbmcs, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer/Foxp3+%2F+Transcription+Factor+Staining+Buffer+Kit/pm41839922-98-0-14
    Average 97 stars, based on 1 article reviews
    surface antigen stained pbmcs - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    foxp3 fix perm buffer  (Cytek Biosciences)
    97
    Cytek Biosciences foxp3 fix perm buffer
    Foxp3 Fix Perm Buffer, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer/Foxp3+%2F+Transcription+Factor+Staining+Buffer+Kit/pm41839922-98-12-14
    Average 97 stars, based on 1 article reviews
    foxp3 fix perm buffer - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    transcription factor staining buffer kit  (Cytek Biosciences)
    97
    Cytek Biosciences transcription factor staining buffer kit
    Transcription Factor Staining Buffer Kit, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer/Foxp3+%2F+Transcription+Factor+Staining+Buffer+Kit/pm41826949-106-8-15
    Average 97 stars, based on 1 article reviews
    transcription factor staining buffer kit - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier

    Image Search Results